Transcript: Mouse XR_001782131.1

PREDICTED: Mus musculus CAP-GLY domain containing linker protein family, member 4 (Clip4), transcript variant X14, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Clip4 (78785)
Length:
4129
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782131.1
NBCI Gene record:
Clip4 (78785)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180352 GCTCTCCGAGATATGGAATAT pLKO.1 1822 3UTR 100% 13.200 18.480 N Clip4 n/a
2 TRCN0000340365 GGCTCATGGCATCGGTGATAT pLKO_005 511 3UTR 100% 13.200 18.480 N Clip4 n/a
3 TRCN0000340439 TTTAGTTGCTCTCCGAGATAT pLKO_005 1815 3UTR 100% 13.200 18.480 N Clip4 n/a
4 TRCN0000180885 GCTCACAAGCTCTAACGAAAT pLKO.1 2099 3UTR 100% 10.800 15.120 N Clip4 n/a
5 TRCN0000340438 GGTTTACTTTACTTAGCTATT pLKO_005 2407 3UTR 100% 10.800 8.640 N Clip4 n/a
6 TRCN0000340441 ATGCCACTTGCAGCGACTTTA pLKO_005 693 3UTR 100% 13.200 9.240 N Clip4 n/a
7 TRCN0000183903 CCTGCACATTGCAGCACATAA pLKO.1 727 3UTR 100% 13.200 9.240 N Clip4 n/a
8 TRCN0000340363 TGTGGGTGACAAGCGCTATTT pLKO_005 2213 3UTR 100% 13.200 9.240 N Clip4 n/a
9 TRCN0000180826 GCAGCAAATAACAGTCACCAT pLKO.1 1632 3UTR 100% 2.640 1.848 N Clip4 n/a
10 TRCN0000135332 CTATTTCACCTGTAAGCCGAA pLKO.1 2228 3UTR 100% 2.160 1.512 N CLIP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.