Transcript: Mouse XR_001782586.1

PREDICTED: Mus musculus family with sequence similarity 160, member B1 (Fam160b1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam160b1 (226252)
Length:
2319
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782586.1
NBCI Gene record:
Fam160b1 (226252)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782586.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217759 CCTCTAAGACATAGGTTAATC pLKO.1 1705 3UTR 100% 13.200 18.480 N Fam160b1 n/a
2 TRCN0000345593 TCGAACATTGCGATCACATAT pLKO_005 1724 3UTR 100% 13.200 18.480 N Fam160b1 n/a
3 TRCN0000215724 CAAGATCTTGGAAACGTTATA pLKO.1 609 3UTR 100% 13.200 9.240 N Fam160b1 n/a
4 TRCN0000178029 GCCAGAAACTCTGTCAGAAAT pLKO.1 1674 3UTR 100% 13.200 9.240 N Fam160b1 n/a
5 TRCN0000345522 GCCAGAAACTCTGTCAGAAAT pLKO_005 1674 3UTR 100% 13.200 9.240 N Fam160b1 n/a
6 TRCN0000375169 ACAAGATCTTGGAAACGTTAT pLKO_005 608 3UTR 100% 10.800 7.560 N Fam160b1 n/a
7 TRCN0000178174 GATCCCTACTTGGTCAACTTT pLKO.1 847 3UTR 100% 5.625 3.938 N Fam160b1 n/a
8 TRCN0000177292 GCGATTACACACTACTACATA pLKO.1 448 3UTR 100% 5.625 3.938 N Fam160b1 n/a
9 TRCN0000198094 CCAGGACTACAACTTAGTGAA pLKO.1 1122 3UTR 100% 4.950 2.970 N Fam160b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782586.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.