Transcript: Mouse XR_001782609.1

PREDICTED: Mus musculus l(3)mbt-like (Drosophila) (L3mbtl1), transcript variant X19, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
L3mbtl1 (241764)
Length:
5752
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782609.1
NBCI Gene record:
L3mbtl1 (241764)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782609.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226028 GGCATGCGGTTCCGGATAAAT pLKO_005 2917 3UTR 100% 15.000 21.000 N L3mbtl1 n/a
2 TRCN0000254691 ACGCGCCACTGAACATGATAG pLKO_005 2942 3UTR 100% 10.800 15.120 N L3mbtl1 n/a
3 TRCN0000254693 CTCCAAAGTATCGCAAGATTC pLKO_005 5644 3UTR 100% 10.800 15.120 N L3mbtl1 n/a
4 TRCN0000254692 ATGGCTGGAGTCACAATTATG pLKO_005 4739 3UTR 100% 13.200 10.560 N L3mbtl1 n/a
5 TRCN0000226027 GAACCCGTAACAGCTACTATT pLKO_005 2809 3UTR 100% 13.200 10.560 N L3mbtl1 n/a
6 TRCN0000218170 GAAGAAGAACCCGTCTAATTT pLKO_005 5579 3UTR 100% 15.000 10.500 N L3mbtl1 n/a
7 TRCN0000254694 CCACACAAAGACCTCCAAATA pLKO_005 5233 3UTR 100% 13.200 9.240 N L3mbtl1 n/a
8 TRCN0000226026 TGCCTACAACCGCCTTCATTA pLKO_005 2684 3UTR 100% 13.200 9.240 N L3mbtl1 n/a
9 TRCN0000226029 TGTGGAGGATCATCGGATAAA pLKO_005 4707 3UTR 100% 13.200 9.240 N L3mbtl1 n/a
10 TRCN0000265593 ACCAGGACCGTCAAGATATAA pLKO_005 3047 3UTR 100% 15.000 9.000 N L3mbtl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782609.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07978 pDONR223 100% 27% None (many diffs) n/a
2 ccsbBroad304_07978 pLX_304 0% 27% V5 (many diffs) n/a
3 TRCN0000478518 AGCGCGATGTGTAACCGAGCGTCA pLX_317 12.9% 27% V5 (many diffs) n/a
Download CSV