Transcript: Mouse XR_001783143.1

PREDICTED: Mus musculus crumbs family member 1, photoreceptor morphogenesis associated (Crb1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Crb1 (170788)
Length:
5067
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001783143.1
NBCI Gene record:
Crb1 (170788)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001783143.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419242 ATAGAGATTGGAGGCATATAT pLKO_005 3681 3UTR 100% 15.000 12.000 N Crb1 n/a
2 TRCN0000099832 GCATTCAAGATGCCAGATTAT pLKO.1 3388 3UTR 100% 13.200 10.560 N Crb1 n/a
3 TRCN0000432370 GATACTGTTGACAGCTATATT pLKO_005 1335 3UTR 100% 15.000 10.500 N Crb1 n/a
4 TRCN0000425169 GATGGAAATGTTCACTTAATA pLKO_005 2751 3UTR 100% 15.000 10.500 N Crb1 n/a
5 TRCN0000438838 TGAATGTGACAGGCCCTATAC pLKO_005 2471 3UTR 100% 10.800 7.560 N Crb1 n/a
6 TRCN0000099834 CGGCCTTTAGTGTTAATGATA pLKO.1 2557 3UTR 100% 5.625 3.938 N Crb1 n/a
7 TRCN0000099831 CCCAAGTTCATGGTAAACTTT pLKO.1 2721 3UTR 100% 0.563 0.394 N Crb1 n/a
8 TRCN0000099833 CCAGTGTCTGAACAATGGAAA pLKO.1 1727 3UTR 100% 4.950 2.970 N Crb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001783143.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.