Transcript: Mouse XR_001783165.1

PREDICTED: Mus musculus myosin, heavy chain 7B, cardiac muscle, beta (Myh7b), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Myh7b (668940)
Length:
6704
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001783165.1
NBCI Gene record:
Myh7b (668940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001783165.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262993 GGCGGTTACAAACGGAGAATG pLKO_005 4102 3UTR 100% 10.800 15.120 N Myh7b n/a
2 TRCN0000140235 GAGCAAGGTCAAGAGCTACAA pLKO.1 5885 3UTR 100% 4.950 3.960 N MYH7B n/a
3 TRCN0000262995 TTCTGGGAAGTCACCTAATTT pLKO_005 1841 3UTR 100% 15.000 10.500 N Myh7b n/a
4 TRCN0000262994 TGCGATCCTGTTGTCTCTTTC pLKO_005 6521 3UTR 100% 10.800 7.560 N Myh7b n/a
5 TRCN0000281574 GAGAAGTGTGCCTGCTATAAG pLKO_005 1206 3UTR 100% 13.200 7.920 N Myh7b n/a
6 TRCN0000140638 GCAGTTCTTCAACCAGCACAT pLKO.1 1631 3UTR 100% 4.050 2.430 N MYH7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001783165.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.