Transcript: Mouse XR_001783172.1

PREDICTED: Mus musculus coiled-coil domain containing 34 (Ccdc34), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc34 (68201)
Length:
2450
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001783172.1
NBCI Gene record:
Ccdc34 (68201)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001783172.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249651 CGTCGACCTCTTAGTGGATTC pLKO_005 468 3UTR 100% 6.000 8.400 N Ccdc34 n/a
2 TRCN0000195982 CCCGGAAAGAAGAGTAAACGA pLKO.1 1885 3UTR 100% 3.000 4.200 N Ccdc34 n/a
3 TRCN0000257927 AGGAATTAAATCAGCAAATAG pLKO_005 848 3UTR 100% 13.200 9.240 N Ccdc34 n/a
4 TRCN0000249649 GTCATCCCTGGCAGTTCATAA pLKO_005 1932 3UTR 100% 13.200 9.240 N Ccdc34 n/a
5 TRCN0000217070 CCAATTCCTTGGAAGCCAATT pLKO.1 1831 3UTR 100% 10.800 7.560 N Ccdc34 n/a
6 TRCN0000216027 CCTAATCAGTAAATCAACATT pLKO.1 2072 3UTR 100% 5.625 3.938 N Ccdc34 n/a
7 TRCN0000178786 CATAATGCCAAGAGCAGTCTT pLKO.1 1948 3UTR 100% 4.950 3.465 N Ccdc34 n/a
8 TRCN0000184775 CCTGGCAGTTCATAATGCCAA pLKO.1 1938 3UTR 100% 0.264 0.185 N Ccdc34 n/a
9 TRCN0000249648 TCCTTGGAAGCCAATTCATAT pLKO_005 1836 3UTR 100% 13.200 7.920 N Ccdc34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001783172.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.