Transcript: Mouse XR_001783215.1

PREDICTED: Mus musculus COMM domain containing 7 (Commd7), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Commd7 (99311)
Length:
4502
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001783215.1
NBCI Gene record:
Commd7 (99311)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001783215.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257619 GCGACAAAGCATTCGAATATA pLKO_005 1243 3UTR 100% 15.000 21.000 N Commd7 n/a
2 TRCN0000247056 CAGGGTTTCAACCTGGTTAAA pLKO_005 624 3UTR 100% 13.200 18.480 N Commd7 n/a
3 TRCN0000145378 GTTGGTGGTTAAGAAAGGAAA pLKO.1 1878 3UTR 100% 4.950 6.930 N COMMD7 n/a
4 TRCN0000184807 CCCGAAATCAAGAGGTTCGAA pLKO.1 686 3UTR 100% 3.000 4.200 N Commd7 n/a
5 TRCN0000257626 GTGAGCCACTTTCTTGAATTG pLKO_005 737 3UTR 100% 10.800 7.560 N Commd7 n/a
6 TRCN0000143685 GAGGAGAAAGCCACTTACTTT pLKO.1 427 3UTR 100% 5.625 3.938 N COMMD7 n/a
7 TRCN0000257607 CAGGTAAGTCTGTGGTCAGTG pLKO_005 595 3UTR 100% 4.050 2.835 N Commd7 n/a
8 TRCN0000257625 CCGAAATCAAGAGGTTCGAAC pLKO_005 687 3UTR 100% 4.050 2.835 N Commd7 n/a
9 TRCN0000417017 CTACAGCTTCCTGCACGAGAT pLKO_005 1941 3UTR 100% 4.050 2.835 N COMMD7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001783215.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.