Transcript: Mouse XR_001783673.1

PREDICTED: Mus musculus helicase-like transcription factor (Hltf), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Hltf (20585)
Length:
3794
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001783673.1
NBCI Gene record:
Hltf (20585)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001783673.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085346 CAGCGCAATGACTTATATTAT pLKO.1 959 3UTR 100% 15.000 21.000 N Hltf n/a
2 TRCN0000311791 CAGCGCAATGACTTATATTAT pLKO_005 959 3UTR 100% 15.000 21.000 N Hltf n/a
3 TRCN0000312836 TTACAACGAGAGCCTAATAAT pLKO_005 416 3UTR 100% 15.000 21.000 N Hltf n/a
4 TRCN0000085343 GCCTAATAATCCCTATGATAA pLKO.1 427 3UTR 100% 13.200 18.480 N Hltf n/a
5 TRCN0000085347 CCATGCCATTCGAAATCCAAA pLKO.1 1822 3UTR 100% 4.950 6.930 N Hltf n/a
6 TRCN0000349351 CCATGCCATTCGAAATCCAAA pLKO_005 1822 3UTR 100% 4.950 6.930 N Hltf n/a
7 TRCN0000085345 GCTATTACACAGGAGTTGTAA pLKO.1 375 3UTR 100% 0.563 0.788 N Hltf n/a
8 TRCN0000085344 GCCACATGCAAAGTGTCCTTT pLKO.1 2521 3UTR 100% 4.950 3.465 N Hltf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001783673.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.