Transcript: Mouse XR_001784105.1

PREDICTED: Mus musculus SUN domain containing ossification factor (Suco), transcript variant X11, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Suco (226551)
Length:
5794
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784105.1
NBCI Gene record:
Suco (226551)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784105.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339352 TAAATCTGAAGGAGGATATAT pLKO_005 2965 3UTR 100% 15.000 21.000 N Suco n/a
2 TRCN0000376913 CAGTATTTATGAGGCTTAATA pLKO_005 3444 3UTR 100% 15.000 10.500 N Suco n/a
3 TRCN0000339419 TCTTGCACCTTCCCATATTTA pLKO_005 4903 3UTR 100% 15.000 10.500 N Suco n/a
4 TRCN0000339418 TTTGTCCTTTAAGCCTAATAA pLKO_005 2034 3UTR 100% 15.000 10.500 N Suco n/a
5 TRCN0000062701 CCAGAAGATATACCAACATTT pLKO.1 1508 3UTR 100% 13.200 9.240 N SUCO n/a
6 TRCN0000376990 GGTGGAGCTGCTATCACATTT pLKO_005 1999 3UTR 100% 13.200 9.240 N Suco n/a
7 TRCN0000339420 TAGTATAGCTGATACACTAAA pLKO_005 3238 3UTR 100% 13.200 9.240 N Suco n/a
8 TRCN0000376989 GCTCAGCAATGTGGGTCATTT pLKO_005 5057 3UTR 100% 13.200 7.920 N Suco n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784105.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.