Transcript: Mouse XR_001784112.1

PREDICTED: Mus musculus KH domain containing, RNA binding, signal transduction associated 1 (Khdrbs1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Khdrbs1 (20218)
Length:
11898
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784112.1
NBCI Gene record:
Khdrbs1 (20218)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784112.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102324 GCATGTCTTCATTGAAGTCTT pLKO.1 1289 3UTR 100% 4.950 6.930 N Khdrbs1 n/a
2 TRCN0000326088 GCATGTCTTCATTGAAGTCTT pLKO_005 1289 3UTR 100% 4.950 6.930 N Khdrbs1 n/a
3 TRCN0000102323 CCAGAAACATACGAAGATTAT pLKO.1 1695 3UTR 100% 13.200 10.560 N Khdrbs1 n/a
4 TRCN0000326160 CCAGAAACATACGAAGATTAT pLKO_005 1695 3UTR 100% 13.200 10.560 N Khdrbs1 n/a
5 TRCN0000102321 CGAGGAGAATTATTTGGATTT pLKO.1 1031 3UTR 100% 10.800 8.640 N Khdrbs1 n/a
6 TRCN0000326090 CGAGGAGAATTATTTGGATTT pLKO_005 1031 3UTR 100% 10.800 8.640 N Khdrbs1 n/a
7 TRCN0000102322 CCAAGATTCTTACGAAGCCTA pLKO.1 1820 3UTR 100% 2.640 2.112 N Khdrbs1 n/a
8 TRCN0000326089 CCAAGATTCTTACGAAGCCTA pLKO_005 1820 3UTR 100% 2.640 2.112 N Khdrbs1 n/a
9 TRCN0000177680 CCATCTGTAATGGGATCTGAT pLKO.1 9458 3UTR 100% 4.950 2.475 Y Etfrf1 n/a
10 TRCN0000131150 GCTGGACCTCTTCTTCCATTA pLKO.1 7602 3UTR 100% 10.800 6.480 N PPP6R1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784112.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.