Transcript: Mouse XR_001784646.1

PREDICTED: Mus musculus cilia and flagella associated protein 69 (Cfap69), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cfap69 (207686)
Length:
4853
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784646.1
NBCI Gene record:
Cfap69 (207686)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175738 GTTCCACAGCTCCTGAAATAA pLKO.1 2939 3UTR 100% 15.000 12.000 N Cfap69 n/a
2 TRCN0000193406 CGATGATTGAATGTGGCTTTA pLKO.1 1205 3UTR 100% 10.800 8.640 N Cfap69 n/a
3 TRCN0000193614 GCAGAACCATTAAAGAAACAT pLKO.1 733 3UTR 100% 5.625 4.500 N Cfap69 n/a
4 TRCN0000216304 GAGATTTGGCACAGATATTTA pLKO.1 482 3UTR 100% 15.000 10.500 N Cfap69 n/a
5 TRCN0000174932 GCGTCAGCTTAGAAATGATAT pLKO.1 1143 3UTR 100% 13.200 9.240 N Cfap69 n/a
6 TRCN0000369636 TTCAAGCCTATGGACCTTAAT pLKO_005 355 3UTR 100% 13.200 9.240 N CFAP69 n/a
7 TRCN0000193185 CGGCAAGATTGTTGATACAAA pLKO.1 2146 3UTR 100% 5.625 3.938 N Cfap69 n/a
8 TRCN0000174817 GCACAGTATGAAGAACTACAA pLKO.1 1468 3UTR 100% 4.950 3.465 N Cfap69 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784646.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08967 pDONR223 100% 46.2% None (many diffs) n/a
Download CSV