Transcript: Mouse XR_001784743.1

PREDICTED: Mus musculus family with sequence similarity 175, member A (Fam175a), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abraxas1 (70681)
Length:
2028
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784743.1
NBCI Gene record:
Abraxas1 (70681)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241239 TCTGATCAACTGGGTTATAAA pLKO_005 892 3UTR 100% 15.000 21.000 N Abraxas1 n/a
2 TRCN0000217863 GTTGTTAACACCGAGTATAAC pLKO.1 771 3UTR 100% 13.200 18.480 N Abraxas1 n/a
3 TRCN0000241237 GATGGATGTAAACCAATTAAA pLKO_005 1104 3UTR 100% 15.000 12.000 N Abraxas1 n/a
4 TRCN0000177298 GCCAAGAATAGCATTACTGAT pLKO.1 493 3UTR 100% 4.950 3.960 N Abraxas1 n/a
5 TRCN0000241236 CTGTGGTGGGTTGGTATAAAT pLKO_005 656 3UTR 100% 15.000 10.500 N Abraxas1 n/a
6 TRCN0000241238 TGTCAAGCTTTGCGAACATTT pLKO_005 1221 3UTR 100% 13.200 9.240 N Abraxas1 n/a
7 TRCN0000177254 GAGAAACTATTGATGGATGTA pLKO.1 1093 3UTR 100% 4.950 3.465 N Abraxas1 n/a
8 TRCN0000197933 GAGAACATCCTTCTTTGTCAA pLKO.1 1206 3UTR 100% 4.950 3.465 N Abraxas1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.