Transcript: Mouse XR_001785583.1

PREDICTED: Mus musculus coiled-coil domain containing 155 (Ccdc155), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc155 (384619)
Length:
2137
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001785583.1
NBCI Gene record:
Ccdc155 (384619)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001785583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200360 GTGAGTGCGAACGACTCATTT pLKO.1 1582 3UTR 100% 1.320 1.848 N Ccdc155 n/a
2 TRCN0000182126 CCCATCACTAGACTTGGAGAT pLKO.1 1805 3UTR 100% 4.050 3.240 N Ccdc155 n/a
3 TRCN0000182139 CCAGGAACTAAGGCAAGAGAT pLKO.1 1685 3UTR 100% 4.950 3.465 N Ccdc155 n/a
4 TRCN0000182290 GAGGAGAATGAGAAGCTGCTA pLKO.1 1488 3UTR 100% 2.640 1.320 Y Ccdc155 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001785583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.