Transcript: Human XR_002956178.1

PREDICTED: Homo sapiens poly(ADP-ribose) polymerase family member 8 (PARP8), transcript variant X14, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PARP8 (79668)
Length:
6436
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956178.1
NBCI Gene record:
PARP8 (79668)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053227 TCCGAGTAATTGGTAATCAAA pLKO.1 1948 3UTR 100% 5.625 7.875 N PARP8 n/a
2 TRCN0000296179 ATTCGAACAGAACCTATAATT pLKO_005 61 3UTR 100% 15.000 10.500 N PARP8 n/a
3 TRCN0000053223 GCAGGCTATGACAGCAATTAA pLKO.1 507 3UTR 100% 15.000 10.500 N PARP8 n/a
4 TRCN0000296222 TAACCCTTTGAATACTGATTT pLKO_005 2089 3UTR 100% 13.200 9.240 N PARP8 n/a
5 TRCN0000053225 GCAATGGGTTATATCAAGTAA pLKO.1 1251 3UTR 100% 5.625 3.938 N PARP8 n/a
6 TRCN0000289293 GCAATGGGTTATATCAAGTAA pLKO_005 1251 3UTR 100% 5.625 3.938 N PARP8 n/a
7 TRCN0000053224 GCCTAACTCTAAAGTCGCATA pLKO.1 581 3UTR 100% 4.050 2.835 N PARP8 n/a
8 TRCN0000289292 GCCTAACTCTAAAGTCGCATA pLKO_005 581 3UTR 100% 4.050 2.835 N PARP8 n/a
9 TRCN0000238094 GGGTTATGGAATCTAGTAAAT pLKO_005 2174 3UTR 100% 13.200 9.240 N Parp8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.