Transcript: Human XR_002956288.1

PREDICTED: Homo sapiens required for meiotic nuclear division 1 homolog (RMND1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RMND1 (55005)
Length:
1940
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956288.1
NBCI Gene record:
RMND1 (55005)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956288.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418893 TTGCTCTAAGGCACCGTATAA pLKO_005 1195 3UTR 100% 13.200 18.480 N RMND1 n/a
2 TRCN0000136018 GTCACTGCAAGAGATATTCAA pLKO.1 1752 3UTR 100% 5.625 7.875 N RMND1 n/a
3 TRCN0000433693 GTGATAACCAAAGTGTCACTG pLKO_005 1738 3UTR 100% 4.050 5.670 N RMND1 n/a
4 TRCN0000138257 CCCTATGAAATCGCACTGGTA pLKO.1 897 3UTR 100% 2.640 2.112 N RMND1 n/a
5 TRCN0000190582 GCCTAGAGATGCAGCAAATAT pLKO.1 731 3UTR 100% 15.000 10.500 N Rmnd1 n/a
6 TRCN0000432196 GTCAATTCCTGAGGCTTTAAA pLKO_005 1115 3UTR 100% 15.000 10.500 N RMND1 n/a
7 TRCN0000424654 GTTTGAGCTGGGACGAGTATT pLKO_005 1706 3UTR 100% 13.200 9.240 N RMND1 n/a
8 TRCN0000136048 GATGAGTATCATCTGGGAAAT pLKO.1 663 3UTR 100% 10.800 7.560 N RMND1 n/a
9 TRCN0000431134 GAGATATTCAAGTTCTACAAT pLKO_005 1762 3UTR 100% 5.625 3.938 N RMND1 n/a
10 TRCN0000137810 GCCGAAGAATCGGTCATCTAA pLKO.1 190 3UTR 100% 5.625 3.938 N RMND1 n/a
11 TRCN0000135089 CTTCCAACCATGAAATCCTTT pLKO.1 408 3UTR 100% 4.950 3.465 N RMND1 n/a
12 TRCN0000137541 CCAAAGTGTCACTGCAAGAGA pLKO.1 1745 3UTR 100% 3.000 2.100 N RMND1 n/a
13 TRCN0000136192 GCTAGTGGTTTGAATAAGTCT pLKO.1 300 3UTR 100% 3.000 2.100 N RMND1 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1819 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956288.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08448 pDONR223 100% 69.3% None (many diffs) n/a
2 ccsbBroad304_08448 pLX_304 0% 69.3% V5 (many diffs) n/a
Download CSV