Transcript: Human XR_002957330.1

PREDICTED: Homo sapiens ATPase plasma membrane Ca2+ transporting 1 (ATP2B1), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP2B1 (490)
Length:
6846
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957330.1
NBCI Gene record:
ATP2B1 (490)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957330.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043072 CGGCATACTTATTCAAGGCAA pLKO.1 1143 3UTR 100% 2.640 3.696 N ATP2B1 n/a
2 TRCN0000333465 CGGCATACTTATTCAAGGCAA pLKO_005 1143 3UTR 100% 2.640 3.696 N ATP2B1 n/a
3 TRCN0000043068 GCCTACAATTTACCTTGTTAA pLKO.1 4512 3UTR 100% 13.200 9.240 N ATP2B1 n/a
4 TRCN0000333527 GCCTACAATTTACCTTGTTAA pLKO_005 4512 3UTR 100% 13.200 9.240 N ATP2B1 n/a
5 TRCN0000101642 CCATAGTATCATTGGGCCTTT pLKO.1 815 3UTR 100% 4.050 2.835 N Atp2b1 n/a
6 TRCN0000043069 CCAGAGAAAGAGGGTGGATTA pLKO.1 2053 3UTR 100% 10.800 6.480 N ATP2B1 n/a
7 TRCN0000333526 CCAGAGAAAGAGGGTGGATTA pLKO_005 2053 3UTR 100% 10.800 6.480 N ATP2B1 n/a
8 TRCN0000043071 GCAGATTTAGAAAGAAGAGAA pLKO.1 688 3UTR 100% 4.950 2.475 Y ATP2B1 n/a
9 TRCN0000333464 GCAGATTTAGAAAGAAGAGAA pLKO_005 688 3UTR 100% 4.950 2.475 Y ATP2B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957330.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.