Transcript: Human XR_002957812.1

PREDICTED: Homo sapiens transcription termination factor 2 (TTF2), transcript variant X13, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTF2 (8458)
Length:
3304
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957812.1
NBCI Gene record:
TTF2 (8458)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957812.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022230 GCTCGAATCATATTGGATGAA pLKO.1 2108 3UTR 100% 4.950 6.930 N TTF2 n/a
2 TRCN0000022232 CCTGACAATGATTGCGCTCAT pLKO.1 1874 3UTR 100% 4.050 5.670 N TTF2 n/a
3 TRCN0000419750 TCAAGCTTGTGACCGAATTTA pLKO_005 3202 3UTR 100% 15.000 10.500 N TTF2 n/a
4 TRCN0000022233 CGTGTCTACCTTACAACACAA pLKO.1 1284 3UTR 100% 4.950 3.465 N TTF2 n/a
5 TRCN0000022229 GCCCTAATAATCCATTCAGTA pLKO.1 2562 3UTR 100% 4.950 3.465 N TTF2 n/a
6 TRCN0000022231 CCCGAATAAAGGAAAGAGCTT pLKO.1 110 3UTR 100% 2.640 1.848 N TTF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957812.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11275 pDONR223 100% 60% None (many diffs) n/a
2 ccsbBroad304_11275 pLX_304 0% 60% V5 (many diffs) n/a
Download CSV