Transcript: Human XR_002958058.1

PREDICTED: Homo sapiens sterol regulatory element binding transcription factor 1 (SREBF1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SREBF1 (6720)
Length:
4021
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958058.1
NBCI Gene record:
SREBF1 (6720)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958058.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220196 GCTGAATAAATCTGCTGTCTT pLKO.1 1268 3UTR 100% 4.950 6.930 N SREBF1 n/a
2 TRCN0000434619 TATTCCGGGAACATCTCTTAG pLKO_005 2611 3UTR 100% 10.800 8.640 N SREBF1 n/a
3 TRCN0000421299 GTGACTTCCCTGGCCTATTTG pLKO_005 322 3UTR 100% 13.200 9.240 N SREBF1 n/a
4 TRCN0000414192 AGACATGCTTCAGCTTATCAA pLKO_005 290 3UTR 100% 5.625 3.938 N SREBF1 n/a
5 TRCN0000220197 CCAGAAACTCAAGCAGGAGAA pLKO.1 1331 3UTR 100% 4.050 2.835 N SREBF1 n/a
6 TRCN0000220195 GCCATCGACTACATTCGCTTT pLKO.1 1296 3UTR 100% 4.050 2.835 N SREBF1 n/a
7 TRCN0000220198 CTTCTCCATCAGTTCCAGCAT pLKO.1 2768 3UTR 100% 2.640 1.848 N SREBF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958058.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroad304_06995 pLX_304 8.6% 82.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_06995 pDONR223 100% 82% None (many diffs) n/a
Download CSV