Transcript: Human XR_002958065.1

PREDICTED: Homo sapiens caspase recruitment domain family member 14 (CARD14), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CARD14 (79092)
Length:
4151
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958065.1
NBCI Gene record:
CARD14 (79092)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958065.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359745 AGGTCAACACGGACGGTTATA pLKO_005 2104 3UTR 100% 13.200 18.480 N CARD14 n/a
2 TRCN0000359744 GTCTGCAGGCCCGATTCAAAT pLKO_005 3509 3UTR 100% 13.200 18.480 N CARD14 n/a
3 TRCN0000107198 CGTCTCTGTCAACGAGAAGAT pLKO.1 2922 3UTR 100% 4.950 3.960 N CARD14 n/a
4 TRCN0000107199 CGTGAACTCTTACACCATGAA pLKO.1 2300 3UTR 100% 4.950 3.960 N CARD14 n/a
5 TRCN0000107197 CGTCAGTATGGACAAAGCCAA pLKO.1 2459 3UTR 100% 2.640 2.112 N CARD14 n/a
6 TRCN0000359672 ATGTTGACTTCAGTAACTTTA pLKO_005 466 3UTR 100% 13.200 9.240 N CARD14 n/a
7 TRCN0000107196 CCAGATTGTGATGGTTGATTA pLKO.1 1979 3UTR 100% 13.200 9.240 N CARD14 n/a
8 TRCN0000359743 GTGCCTCCTCCAAGGGTTTAA pLKO_005 2685 3UTR 100% 13.200 9.240 N CARD14 n/a
9 TRCN0000107195 GCCACTTGTAACTGCACACTT pLKO.1 3343 3UTR 100% 4.950 3.465 N CARD14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958065.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.