Transcript: Human XR_002958631.1

PREDICTED: Homo sapiens transient receptor potential cation channel subfamily M member 2 (TRPM2), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRPM2 (7226)
Length:
6366
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958631.1
NBCI Gene record:
TRPM2 (7226)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958631.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044149 GCAGAAACTGAGCGTGTTCTT pLKO.1 1648 3UTR 100% 4.950 6.930 N TRPM2 n/a
2 TRCN0000157541 GACCTTCTCATTTGGGCCATT pLKO.1 2378 3UTR 100% 4.050 5.670 N TRPM2 n/a
3 TRCN0000044150 CTGATCTATGACCCACCCTTT pLKO.1 4669 3UTR 100% 4.050 3.240 N TRPM2 n/a
4 TRCN0000044151 GAAGAAAGAATGCGTGTATTT pLKO.1 712 3UTR 100% 13.200 9.240 N TRPM2 n/a
5 TRCN0000044152 CCTGAACATCCTCTCCTACTT pLKO.1 2908 3UTR 100% 4.950 3.465 N TRPM2 n/a
6 TRCN0000150664 GAAAGTTCCAAACTGTCTGAT pLKO.1 737 3UTR 100% 4.950 3.465 N TRPM2 n/a
7 TRCN0000154997 GCCCAAGATCATCATTGTGAA pLKO.1 3271 3UTR 100% 4.950 3.465 N TRPM2 n/a
8 TRCN0000158267 CGGCAACAATGACAAGCAAGA pLKO.1 658 3UTR 100% 4.050 2.835 N TRPM2 n/a
9 TRCN0000044148 GCCTGAGTTTGTGAAGCTCTT pLKO.1 1996 3UTR 100% 4.050 2.835 N TRPM2 n/a
10 TRCN0000157623 CAAACTGTCTGATGCTGGGAA pLKO.1 745 3UTR 100% 2.640 1.848 N TRPM2 n/a
11 TRCN0000154454 GAGTACATACTGGATGAGGAT pLKO.1 1295 3UTR 100% 2.640 1.848 N TRPM2 n/a
12 TRCN0000156505 GCTGGAGAAGTTCATATCGGA pLKO.1 1420 3UTR 100% 0.750 0.525 N TRPM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958631.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.