Transcript: Human XR_002958702.1

PREDICTED: Homo sapiens mediator complex subunit 15 (MED15), transcript variant X13, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MED15 (51586)
Length:
3921
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958702.1
NBCI Gene record:
MED15 (51586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958702.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275150 TCTCGTGGCCAGGCTCATTAT pLKO_005 279 3UTR 100% 13.200 18.480 N MED15 n/a
2 TRCN0000018969 GCTCAGAACCAACCATCACAA pLKO.1 1039 3UTR 100% 4.950 6.930 N MED15 n/a
3 TRCN0000018972 TCCGTCAGTGATCCTATGAAT pLKO.1 337 3UTR 100% 5.625 4.500 N MED15 n/a
4 TRCN0000275152 TCCGTCAGTGATCCTATGAAT pLKO_005 337 3UTR 100% 5.625 4.500 N MED15 n/a
5 TRCN0000275099 CAACAGCAGCTGCAGCGAATA pLKO_005 811 3UTR 100% 10.800 7.560 N MED15 n/a
6 TRCN0000018970 CGACCAAACAGCAGTACCTAT pLKO.1 2009 3UTR 100% 4.950 3.465 N MED15 n/a
7 TRCN0000175270 CATGATCAACAAGATCGACAA pLKO.1 1821 3UTR 100% 4.050 2.835 N Med15 n/a
8 TRCN0000277061 CATGATCAACAAGATCGACAA pLKO_005 1821 3UTR 100% 4.050 2.835 N Med15 n/a
9 TRCN0000018973 CCGCTGACTATCCTGCCCAAA pLKO.1 2814 3UTR 100% 1.350 0.945 N MED15 n/a
10 TRCN0000275100 CCGCTGACTATCCTGCCCAAA pLKO_005 2814 3UTR 100% 1.350 0.945 N MED15 n/a
11 TRCN0000018971 CGACAAGAACGAAGACAGAAA pLKO.1 1836 3UTR 100% 4.950 2.970 N MED15 n/a
12 TRCN0000275151 GAGGACATAGGAAACCCTTAA pLKO_005 3399 3UTR 100% 10.800 5.400 Y MED15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958702.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.