Transcript: Human XR_002959169.1

PREDICTED: Homo sapiens uncharacterized LOC112268400 (LOC112268400), transcript variant X3, ncRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC112268400 (112268400)
Length:
3996
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002959169.1
NBCI Gene record:
LOC112268400 (112268400)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002959169.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002959169.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10618 pDONR223 100% 6.7% None 1_1915del;1975G>A;2186_3996del n/a
2 ccsbBroad304_10618 pLX_304 0% 6.7% V5 1_1915del;1975G>A;2186_3996del n/a
3 TRCN0000476141 GCCGAACCGGTTGTTCTTGATCTC pLX_317 100% 6.7% V5 1_1915del;1975G>A;2186_3996del n/a
Download CSV