Transcript: Human XR_002959279.1

PREDICTED: Homo sapiens isoamyl acetate hydrolyzing esterase 1 (putative) (IAH1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IAH1 (285148)
Length:
9986
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002959279.1
NBCI Gene record:
IAH1 (285148)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002959279.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253669 GGAGTACGCTGCGAACCTAAA pLKO_005 922 3UTR 100% 10.800 15.120 N IAH1 n/a
2 TRCN0000253668 CAGGACTTCTCATCTTATTTA pLKO_005 1169 3UTR 100% 15.000 10.500 N IAH1 n/a
3 TRCN0000253666 GAATATGCCAATGCGTGTTTA pLKO_005 1088 3UTR 100% 13.200 9.240 N IAH1 n/a
4 TRCN0000370959 GGCCAATGACAGTGCACTAAA pLKO_005 868 3UTR 100% 13.200 9.240 N IAH1 n/a
5 TRCN0000198232 GATGTTCTGAATCGTGGATTT pLKO.1 749 3UTR 100% 10.800 7.560 N Iah1 n/a
6 TRCN0000265423 GATGTTCTGAATCGTGGATTT pLKO_005 749 3UTR 100% 10.800 7.560 N IAH1 n/a
7 TRCN0000297583 GATGTTCTGAATCGTGGATTT pLKO_005 749 3UTR 100% 10.800 7.560 N Iah1 n/a
8 TRCN0000370926 GGGAAGAACAGTGCATCATAC pLKO_005 1029 3UTR 100% 10.800 7.560 N IAH1 n/a
9 TRCN0000370991 TCCCTGAGAATCGAGTCATTC pLKO_005 975 3UTR 100% 10.800 7.560 N IAH1 n/a
10 TRCN0000253667 ATCACAGGAGACCCAAATCTG pLKO_005 1358 3UTR 100% 4.950 3.465 N IAH1 n/a
11 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 4361 3UTR 100% 10.800 5.400 Y MRPS16 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6854 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 4361 3UTR 100% 10.800 5.400 Y CD3EAP n/a
14 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 7032 3UTR 100% 4.950 2.475 Y DCAF11 n/a
15 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 4231 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002959279.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05389 pDONR223 100% 6.8% None (many diffs) n/a
2 ccsbBroad304_05389 pLX_304 0% 6.8% V5 (many diffs) n/a
Download CSV