Transcript: Human XR_002959509.1

PREDICTED: Homo sapiens Kruppel like factor 15 (KLF15), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLF15 (28999)
Length:
5137
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002959509.1
NBCI Gene record:
KLF15 (28999)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002959509.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229891 AGTTGGGTATCTGGGTGATAG pLKO_005 188 3UTR 100% 10.800 15.120 N KLF15 n/a
2 TRCN0000019833 CCCGAGTTTCCTTTGGGTGAT pLKO.1 501 3UTR 100% 4.050 5.670 N KLF15 n/a
3 TRCN0000229894 CCAGCCGCAGAACTCATCAAA pLKO_005 1071 3UTR 100% 5.625 4.500 N KLF15 n/a
4 TRCN0000019829 CAGTTGGGTATCTGGGTGATA pLKO.1 187 3UTR 100% 4.950 3.960 N KLF15 n/a
5 TRCN0000229893 TGAACCTGCCCTCCAAGTTTG pLKO_005 949 3UTR 100% 10.800 7.560 N KLF15 n/a
6 TRCN0000229892 CTACCCTGGAGGAGATTGAAG pLKO_005 550 3UTR 100% 4.950 3.465 N KLF15 n/a
7 TRCN0000019830 CTGGAGGAGATTGAAGAGTTT pLKO.1 555 3UTR 100% 4.950 3.465 N KLF15 n/a
8 TRCN0000019831 GTCTCTGAAGATGACAGCGAT pLKO.1 249 3UTR 100% 2.640 1.848 N KLF15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002959509.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08100 pDONR223 100% 22.6% None (many diffs) n/a
2 ccsbBroad304_08100 pLX_304 0% 22.6% V5 (many diffs) n/a
Download CSV