Transcript: Human XR_002959539.1

PREDICTED: Homo sapiens CTP synthase 1 (CTPS1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CTPS1 (1503)
Length:
2741
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002959539.1
NBCI Gene record:
CTPS1 (1503)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002959539.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000331171 TGATCTTGTAGCGGATGATTC pLKO_005 1822 3UTR 100% 10.800 15.120 N CTPS1 n/a
2 TRCN0000369479 CTCAACTACCTCGCATCATTG pLKO_005 2121 3UTR 100% 10.800 8.640 N CTPS1 n/a
3 TRCN0000369478 CGCCTCACCAAGGACAATAAT pLKO_005 386 3UTR 100% 15.000 10.500 N CTPS1 n/a
4 TRCN0000296990 ACCTTGACCTGGGTAACTATG pLKO_005 348 3UTR 100% 10.800 7.560 N CTPS1 n/a
5 TRCN0000045348 CCCTCATATCACAGATGCAAT pLKO.1 487 3UTR 100% 4.950 3.465 N CTPS1 n/a
6 TRCN0000045352 GCGTTAATACCTGTAGATGAA pLKO.1 530 3UTR 100% 4.950 3.465 N CTPS1 n/a
7 TRCN0000291572 GCGTTAATACCTGTAGATGAA pLKO_005 530 3UTR 100% 4.950 3.465 N CTPS1 n/a
8 TRCN0000045349 GCTCTCACATTACCTCCAGAA pLKO.1 1698 3UTR 100% 4.050 2.430 N CTPS1 n/a
9 TRCN0000291521 GCTCTCACATTACCTCCAGAA pLKO_005 1698 3UTR 100% 4.050 2.430 N CTPS1 n/a
10 TRCN0000045350 CCCTTGTTGTTAGAGGAGCAA pLKO.1 905 3UTR 100% 2.640 1.584 N CTPS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002959539.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.