Transcript: Mouse XR_003950477.1

PREDICTED: Mus musculus pitrilysin metallepetidase 1 (Pitrm1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Pitrm1 (69617)
Length:
3329
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_003950477.1
NBCI Gene record:
Pitrm1 (69617)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_003950477.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031651 GCCAGCGATTACACGATATAT pLKO.1 470 3UTR 100% 15.000 21.000 N Pitrm1 n/a
2 TRCN0000324878 GCCAGCGATTACACGATATAT pLKO_005 470 3UTR 100% 15.000 21.000 N Pitrm1 n/a
3 TRCN0000031652 CGGATCAAGAAGTATCTACTA pLKO.1 2218 3UTR 100% 4.950 6.930 N Pitrm1 n/a
4 TRCN0000324790 CGGATCAAGAAGTATCTACTA pLKO_005 2218 3UTR 100% 4.950 6.930 N Pitrm1 n/a
5 TRCN0000031653 CGTGTATTTGGATGCAACTTT pLKO.1 535 3UTR 100% 5.625 4.500 N Pitrm1 n/a
6 TRCN0000031649 GCCCGTCTAATGACAGCTAAA pLKO.1 2575 3UTR 100% 10.800 7.560 N Pitrm1 n/a
7 TRCN0000324874 GCCCGTCTAATGACAGCTAAA pLKO_005 2575 3UTR 100% 10.800 7.560 N Pitrm1 n/a
8 TRCN0000031650 CCAGACGACAAGTATTATGAA pLKO.1 1568 3UTR 100% 5.625 3.938 N Pitrm1 n/a
9 TRCN0000353949 CCAGACGACAAGTATTATGAA pLKO_005 1568 3UTR 100% 5.625 3.938 N Pitrm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_003950477.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.