Transcript: Mouse XR_003951451.1

PREDICTED: Mus musculus cleavage and polyadenylation specific factor 1 (Cpsf1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Cpsf1 (94230)
Length:
4435
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_003951451.1
NBCI Gene record:
Cpsf1 (94230)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_003951451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123709 CCGCAATCTTATGGTGTATAT pLKO.1 3860 3UTR 100% 13.200 18.480 N Cpsf1 n/a
2 TRCN0000317212 CCGCAATCTTATGGTGTATAT pLKO_005 3860 3UTR 100% 13.200 18.480 N Cpsf1 n/a
3 TRCN0000313683 ACTGCTAAACCGCTACCTATA pLKO_005 4241 3UTR 100% 10.800 15.120 N Cpsf1 n/a
4 TRCN0000313682 CGGCTGGTATTCCTAGTTAAG pLKO_005 2584 3UTR 100% 10.800 15.120 N Cpsf1 n/a
5 TRCN0000123712 CCGAGCGTTTCACTTTGACAA pLKO.1 1254 3UTR 100% 4.950 6.930 N Cpsf1 n/a
6 TRCN0000313685 TCCGCTACTTTGAGGATATTT pLKO_005 2969 3UTR 100% 15.000 10.500 N Cpsf1 n/a
7 TRCN0000123710 GCGGCTGGTATTCCTAGTTAA pLKO.1 2583 3UTR 100% 13.200 9.240 N Cpsf1 n/a
8 TRCN0000313684 ATTGAGAGAGACGACAGATAC pLKO_005 3355 3UTR 100% 10.800 7.560 N Cpsf1 n/a
9 TRCN0000123711 GCCTTTGGTTAAGGAGGTGTT pLKO.1 2706 3UTR 100% 4.050 2.835 N Cpsf1 n/a
10 TRCN0000123713 CCTGACATTATCCTGGATGAT pLKO.1 4311 3UTR 100% 4.950 2.970 N Cpsf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_003951451.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.