Transcript: Mouse XR_105954.4

PREDICTED: Mus musculus RIKEN cDNA F830208F22 gene (F830208F22Rik), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
F830208F22Rik (619308)
Length:
4312
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_105954.4
NBCI Gene record:
F830208F22Rik (619308)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_105954.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189588 CCTATGCTGCTATCGCTACAA pLKO.1 3319 3UTR 100% 4.950 6.930 N F830208F22Rik n/a
2 TRCN0000216795 GATTGCAGGCTTTAGTCTAAA pLKO.1 3370 3UTR 100% 13.200 9.240 N F830208F22Rik n/a
3 TRCN0000190137 GCTATCGCTACAAGGAATGGA pLKO.1 3327 3UTR 100% 3.000 2.100 N F830208F22Rik n/a
4 TRCN0000202264 GCAACTTTGGAGTTCCACTGT pLKO.1 2991 3UTR 100% 2.640 1.848 N F830208F22Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_105954.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.