Transcript: Human XR_243043.3

PREDICTED: Homo sapiens arginine and glutamate rich 1 (ARGLU1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARGLU1 (55082)
Length:
3609
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_243043.3
NBCI Gene record:
ARGLU1 (55082)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_243043.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143314 GAAACAGCACGAAGAGTAGAA pLKO.1 630 3UTR 100% 4.950 6.930 N ARGLU1 n/a
2 TRCN0000122608 GAGCGAATACTGGAAGAGAAT pLKO.1 2722 3UTR 100% 4.950 3.960 N ARGLU1 n/a
3 TRCN0000143718 GTTCCAAATCTCGGGAAAGTA pLKO.1 364 3UTR 100% 5.625 3.938 N ARGLU1 n/a
4 TRCN0000139756 CCAGGGTATTACTGGACCTAT pLKO.1 3375 3UTR 100% 4.950 3.465 N ARGLU1 n/a
5 TRCN0000140601 GAGCAGCAAGCACAACAAGAA pLKO.1 293 3UTR 100% 4.950 3.465 N ARGLU1 n/a
6 TRCN0000144660 GAGGAAAGGATGAAACTAGAA pLKO.1 2821 3UTR 100% 4.950 3.465 N ARGLU1 n/a
7 TRCN0000121827 GATGAAATTGAACGAGAAGTT pLKO.1 696 3UTR 100% 4.950 3.465 N ARGLU1 n/a
8 TRCN0000143214 GAACAAGAACGACAACGTCAA pLKO.1 2839 3UTR 100% 4.050 2.835 N ARGLU1 n/a
9 TRCN0000140211 GCTAGAGCGAATACTGGAAGA pLKO.1 2718 3UTR 100% 4.050 2.835 N ARGLU1 n/a
10 TRCN0000121700 CGAAGAGTAGAAGAATTGGTA pLKO.1 639 3UTR 100% 3.000 2.100 N ARGLU1 n/a
11 TRCN0000144680 GAAAGATTCATGAGGAAAGGA pLKO.1 2810 3UTR 100% 3.000 2.100 N ARGLU1 n/a
12 TRCN0000140602 GAAGCCAAACGCATCATGGAA pLKO.1 732 3UTR 100% 3.000 2.100 N ARGLU1 n/a
13 TRCN0000144710 GAGTAGAAGAATTGGTAGCAA pLKO.1 643 3UTR 100% 3.000 2.100 N ARGLU1 n/a
14 TRCN0000216403 GAGAATTGTTGAAGAACAAAG pLKO.1 2790 3UTR 100% 1.080 0.756 N Arglu1 n/a
15 TRCN0000139195 CAAGAGCAGCAAGCACAACAA pLKO.1 290 3UTR 100% 4.950 2.970 N ARGLU1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_243043.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12153 pDONR223 100% 22.6% None 1_245del;983A>G;1065_3609del n/a
2 ccsbBroad304_12153 pLX_304 0% 22.6% V5 1_245del;983A>G;1065_3609del n/a
Download CSV