Transcript: Human XR_243047.3

PREDICTED: Homo sapiens cysteinyl-tRNA synthetase 2, mitochondrial (CARS2), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CARS2 (79587)
Length:
1980
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_243047.3
NBCI Gene record:
CARS2 (79587)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_243047.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233108 TTGCTCGTGGGAACGCTTATT pLKO_005 579 3UTR 100% 13.200 18.480 N CARS2 n/a
2 TRCN0000141201 CAGGTGGGATAGATTTAGCTT pLKO.1 858 3UTR 100% 3.000 2.400 N CARS2 n/a
3 TRCN0000233109 CCATCGCTAGTATGGTATTTG pLKO_005 816 3UTR 100% 13.200 9.240 N CARS2 n/a
4 TRCN0000233106 CTTGGCCATGCTTGCTCATAT pLKO_005 302 3UTR 100% 13.200 9.240 N CARS2 n/a
5 TRCN0000233107 TAGTCATGGTGATGGGTATTA pLKO_005 375 3UTR 100% 13.200 9.240 N CARS2 n/a
6 TRCN0000141900 GAGGAGACAAGTATGGCAAAT pLKO.1 639 3UTR 100% 10.800 7.560 N CARS2 n/a
7 TRCN0000139785 CACGCCAAAGGCAAAGAAGAA pLKO.1 968 3UTR 100% 4.950 3.465 N CARS2 n/a
8 TRCN0000144985 GATGGGTATTACAGATGTAGA pLKO.1 385 3UTR 100% 4.950 3.465 N CARS2 n/a
9 TRCN0000141965 GCATCAACATCAAGGACAGAA pLKO.1 1768 3UTR 100% 4.950 3.465 N CARS2 n/a
10 TRCN0000140696 GCATAGTCATGGTGATGGGTA pLKO.1 372 3UTR 100% 2.640 1.848 N CARS2 n/a
11 TRCN0000140113 GAAGCAGTACAACATCCACGT pLKO.1 1786 3UTR 100% 2.160 1.512 N CARS2 n/a
12 TRCN0000144239 CAGTCTTTATGAGGAAGACTT pLKO.1 460 3UTR 100% 0.495 0.347 N CARS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_243047.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.