Transcript: Human XR_243974.3

PREDICTED: Homo sapiens DExH-box helicase 34 (DHX34), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DHX34 (9704)
Length:
4359
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_243974.3
NBCI Gene record:
DHX34 (9704)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_243974.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236460 GGAGCACGGATTGTGAATAAA pLKO_005 3949 3UTR 100% 15.000 21.000 N DHX34 n/a
2 TRCN0000236459 GCCGACCAGGACAAGGTATTT pLKO_005 1570 3UTR 100% 13.200 18.480 N DHX34 n/a
3 TRCN0000236457 GCGGCATCTCCACAACGATTT pLKO_005 1161 3UTR 100% 10.800 15.120 N DHX34 n/a
4 TRCN0000064571 CACGGCATCCAAGATTCCTTA pLKO.1 3357 3UTR 100% 4.950 6.930 N DHX34 n/a
5 TRCN0000064569 GCTTCGTAGTAGATTCCGGAA pLKO.1 1670 3UTR 100% 2.160 3.024 N DHX34 n/a
6 TRCN0000236461 TCGCTCTTCTCCAGCTATTTC pLKO_005 1261 3UTR 100% 13.200 9.240 N DHX34 n/a
7 TRCN0000236458 GATCCGCTTCGTAGTAGATTC pLKO_005 1665 3UTR 100% 10.800 7.560 N DHX34 n/a
8 TRCN0000064570 CGAAAGGACTCAGACCAGATT pLKO.1 2776 3UTR 100% 4.950 3.465 N DHX34 n/a
9 TRCN0000064568 GCAGAGATTCCAGAATCTCAA pLKO.1 513 3UTR 100% 0.495 0.347 N DHX34 n/a
10 TRCN0000064572 CTGTTGCACTACCTGGACTTT pLKO.1 721 3UTR 100% 4.950 2.970 N DHX34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_243974.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.