Transcript: Human XR_245151.1

PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif 9 (ADAMTS9), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADAMTS9 (56999)
Length:
7807
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_245151.1
NBCI Gene record:
ADAMTS9 (56999)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_245151.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364353 CACCGCCAATGCCGGATTTAT pLKO_005 682 3UTR 100% 15.000 21.000 N ADAMTS9 n/a
2 TRCN0000046634 CCGTAGAAAGAATTAACTCAA pLKO.1 2847 3UTR 100% 4.950 6.930 N ADAMTS9 n/a
3 TRCN0000046636 CCTCTATCTATAAAGACCCAA pLKO.1 1317 3UTR 100% 2.640 3.696 N ADAMTS9 n/a
4 TRCN0000046637 CGGCCAGCAGTTTCTATTTAA pLKO.1 658 3UTR 100% 15.000 12.000 N ADAMTS9 n/a
5 TRCN0000046635 GCTGTTCTATTAGTGAAGATA pLKO.1 1593 3UTR 100% 5.625 4.500 N ADAMTS9 n/a
6 TRCN0000364280 ATGCATCATTGGGACTTATAT pLKO_005 3742 3UTR 100% 15.000 10.500 N ADAMTS9 n/a
7 TRCN0000364351 ATTGTAGCCTCTATCTATAAA pLKO_005 1310 3UTR 100% 15.000 10.500 N ADAMTS9 n/a
8 TRCN0000364349 GTTTGGTGAAGATCGATTAAA pLKO_005 3583 3UTR 100% 15.000 10.500 N ADAMTS9 n/a
9 TRCN0000376387 TGTGCGCTGGGTCCCTAAATA pLKO_005 2353 3UTR 100% 15.000 10.500 N ADAMTS9 n/a
10 TRCN0000364281 CCATCATCAAGGTGCTATAAG pLKO_005 6750 3UTR 100% 13.200 9.240 N ADAMTS9 n/a
11 TRCN0000364348 GCATCCTTTACAACGTGAATA pLKO_005 1878 3UTR 100% 13.200 9.240 N ADAMTS9 n/a
12 TRCN0000364278 CAGACGATGACAACTACTTAG pLKO_005 2712 3UTR 100% 10.800 7.560 N ADAMTS9 n/a
13 TRCN0000046633 GCACACATCAAGAGAAAGTTA pLKO.1 3453 3UTR 100% 5.625 3.938 N ADAMTS9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_245151.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.