Transcript: Human XR_245556.1

PREDICTED: Homo sapiens synaptojanin 2 (SYNJ2), transcript variant X11, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYNJ2 (8871)
Length:
7291
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_245556.1
NBCI Gene record:
SYNJ2 (8871)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_245556.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234540 CAAGATGCACATCGCTATTAA pLKO_005 6178 3UTR 100% 15.000 21.000 N SYNJ2 n/a
2 TRCN0000234536 GCGACACGCCTATGATCAATT pLKO_005 1089 3UTR 100% 13.200 18.480 N SYNJ2 n/a
3 TRCN0000359696 GCTCGGACTGGAATAAGTAAA pLKO_005 3451 3UTR 100% 13.200 18.480 N SYNJ2 n/a
4 TRCN0000234537 CACGCTCTCATAGATACATTC pLKO_005 1953 3UTR 100% 10.800 15.120 N SYNJ2 n/a
5 TRCN0000359699 TCCTGTTAAATTCGGTGTATG pLKO_005 4719 3UTR 100% 10.800 15.120 N SYNJ2 n/a
6 TRCN0000359729 TACCGCATTGATCTTACTTAT pLKO_005 2291 3UTR 100% 0.000 0.000 N SYNJ2 n/a
7 TRCN0000359766 TTGGACCCACCTACAAGTATG pLKO_005 2433 3UTR 100% 10.800 8.640 N SYNJ2 n/a
8 TRCN0000050374 CGAGAGGAGATCATTCGGAAA pLKO.1 2911 3UTR 100% 4.050 3.240 N SYNJ2 n/a
9 TRCN0000359796 GAATTGAGCGCAGGGAATATT pLKO_005 1874 3UTR 100% 15.000 10.500 N SYNJ2 n/a
10 TRCN0000050373 CCTACGATACAAGCGACAAAT pLKO.1 2469 3UTR 100% 13.200 9.240 N SYNJ2 n/a
11 TRCN0000234538 CCTACGATACAAGCGACAAAT pLKO_005 2469 3UTR 100% 13.200 9.240 N SYNJ2 n/a
12 TRCN0000359765 CTCTTGAGGCCACAGTTAAAG pLKO_005 1160 3UTR 100% 13.200 9.240 N SYNJ2 n/a
13 TRCN0000234539 GGATGCCACTGTTGTAGTAAA pLKO_005 2652 3UTR 100% 13.200 9.240 N SYNJ2 n/a
14 TRCN0000359767 GCGTCTGTCTTTATATCTTTG pLKO_005 1998 3UTR 100% 10.800 7.560 N SYNJ2 n/a
15 TRCN0000050376 GAAGTCATTAAAGGACAGTAT pLKO.1 248 3UTR 100% 4.950 3.465 N SYNJ2 n/a
16 TRCN0000050375 CCGGAAGAACAGTTTGAGCAA pLKO.1 3742 3UTR 100% 2.640 1.848 N SYNJ2 n/a
17 TRCN0000379648 AGCAGCATCCAACGTACAAAG pLKO_005 3176 3UTR 100% 10.800 6.480 N SYNJ2 n/a
18 TRCN0000050377 CCCACCTACAAGTATGACGTT pLKO.1 2438 3UTR 100% 2.640 1.584 N SYNJ2 n/a
19 TRCN0000359697 GAGGTCGTTGTGACCATTAAT pLKO_005 4927 3UTR 100% 15.000 21.000 N SYNJ2 n/a
20 TRCN0000182331 GCTGCTGAAGATCATCTGCTA pLKO.1 646 3UTR 100% 2.640 1.848 N Fbxo36 n/a
21 TRCN0000293028 GCTGCTGAAGATCATCTGCTA pLKO_005 646 3UTR 100% 2.640 1.848 N Fbxo36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_245556.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.