Transcript: Human XR_246103.3

PREDICTED: Homo sapiens uroporphyrinogen III synthase (UROS), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UROS (7390)
Length:
1283
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_246103.3
NBCI Gene record:
UROS (7390)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_246103.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045781 TCAGTGTATGTGGTTGGAAAT pLKO.1 406 3UTR 100% 10.800 8.640 N UROS n/a
2 TRCN0000291000 TCAGTGTATGTGGTTGGAAAT pLKO_005 406 3UTR 100% 10.800 8.640 N UROS n/a
3 TRCN0000045779 CAGGAGTTATCTGGTGACAAT pLKO.1 820 3UTR 100% 4.950 3.960 N UROS n/a
4 TRCN0000291002 CAGGAGTTATCTGGTGACAAT pLKO_005 820 3UTR 100% 4.950 3.960 N UROS n/a
5 TRCN0000045780 GATCCGTATATCAGGGAATTA pLKO.1 172 3UTR 100% 13.200 9.240 N UROS n/a
6 TRCN0000291001 GATCCGTATATCAGGGAATTA pLKO_005 172 3UTR 100% 13.200 9.240 N UROS n/a
7 TRCN0000045778 GCAGAGTTATGTTTGGAGCAA pLKO.1 331 3UTR 100% 2.640 1.848 N UROS n/a
8 TRCN0000045782 TCAAATTAAGTTTGCAGCCAT pLKO.1 846 3UTR 100% 2.640 1.848 N UROS n/a
9 TRCN0000290937 TCAAATTAAGTTTGCAGCCAT pLKO_005 846 3UTR 100% 2.640 1.848 N UROS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_246103.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01759 pDONR223 100% 61.9% None 1_123del;599_670del;991_1283del n/a
2 ccsbBroad304_01759 pLX_304 0% 61.9% V5 1_123del;599_670del;991_1283del n/a
Download CSV