Transcript: Mouse XR_374432.3

PREDICTED: Mus musculus sodium channel, voltage-gated, type IX, alpha (Scn9a), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Scn9a (20274)
Length:
4987
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_374432.3
NBCI Gene record:
Scn9a (20274)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_374432.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069393 GCTGCTGAGTACACGAGTTTA pLKO.1 2458 3UTR 100% 13.200 9.240 N LOC269279 n/a
2 TRCN0000069395 GCCAACATCGAAGAAGCTAAA pLKO.1 2359 3UTR 100% 10.800 7.560 N LOC269279 n/a
3 TRCN0000069396 CCTTGAGCAGAATGAAACATT pLKO.1 1965 3UTR 100% 5.625 3.938 N LOC269279 n/a
4 TRCN0000069397 GCAGATGTTAGACCGACTCAA pLKO.1 2400 3UTR 100% 4.950 3.465 N LOC269279 n/a
5 TRCN0000069394 GCTGATGATGAGCATAGCATT pLKO.1 2836 3UTR 100% 4.950 3.465 N LOC269279 n/a
6 TRCN0000044503 GCCCTCATTGAACAACGCATT pLKO.1 1189 3UTR 100% 4.050 2.835 N SCN9A n/a
7 TRCN0000173545 GCTGTTTGGAAAGAGCTACAA pLKO.1 3783 3UTR 100% 4.950 2.475 Y Scn3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_374432.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.