Transcript: Mouse XR_375607.3

PREDICTED: Mus musculus tripartite motif-containing 33 (Trim33), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trim33 (94093)
Length:
2299
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_375607.3
NBCI Gene record:
Trim33 (94093)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_375607.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322586 GATGCTGGCTCAAGTAGTTTA pLKO_005 2233 3UTR 100% 13.200 18.480 N TRIM33 n/a
2 TRCN0000039530 CGTGTGATAGATTGACGTGTA pLKO.1 1017 3UTR 100% 4.050 5.670 N Trim33 n/a
3 TRCN0000302197 CGTGTGATAGATTGACGTGTA pLKO_005 1017 3UTR 100% 4.050 5.670 N Trim33 n/a
4 TRCN0000022006 GCTCCTGGTTATACTCCTAAT pLKO.1 1595 3UTR 100% 10.800 8.640 N TRIM33 n/a
5 TRCN0000196330 GCTCAAGTAGTTTAGATAATC pLKO.1 2240 3UTR 100% 13.200 9.240 N TRIM33 n/a
6 TRCN0000039529 CGTCTGTTACAGCAATAGAAT pLKO.1 2144 3UTR 100% 5.625 3.938 N Trim33 n/a
7 TRCN0000039532 CCACCTATACAGTTGGAAGAT pLKO.1 2215 3UTR 100% 4.950 3.465 N Trim33 n/a
8 TRCN0000039533 GCAGCTACACAAGTGCAGAAT pLKO.1 1166 3UTR 100% 4.950 3.465 N Trim33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_375607.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.