Transcript: Mouse XR_376360.3

PREDICTED: Mus musculus SH3-domain GRB2-like (endophilin) interacting protein 1 (Sgip1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sgip1 (73094)
Length:
10605
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_376360.3
NBCI Gene record:
Sgip1 (73094)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_376360.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116646 GCTGAGCAGACCTTCATTAAA pLKO.1 1429 3UTR 100% 15.000 12.000 N SGIP1 n/a
2 TRCN0000192408 CCAACTTCTCTGCTGTGATAA pLKO.1 2160 3UTR 100% 13.200 9.240 N Sgip1 n/a
3 TRCN0000201007 CCCAAGTCTGTTGCTGTTAAT pLKO.1 1183 3UTR 100% 13.200 9.240 N Sgip1 n/a
4 TRCN0000191491 GCTTCAGTTTAGTGGGTTAAA pLKO.1 3778 3UTR 100% 13.200 9.240 N Sgip1 n/a
5 TRCN0000217739 GGTTCTTTACTGGCGAGATTT pLKO.1 3076 3UTR 100% 13.200 9.240 N Sgip1 n/a
6 TRCN0000192995 GCCTTTGGAATACGGAAGAAA pLKO.1 232 3UTR 100% 5.625 3.938 N Sgip1 n/a
7 TRCN0000191317 CCTTGTTTCTTCTTTACTCAT pLKO.1 4207 3UTR 100% 4.950 2.970 N Sgip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_376360.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.