Transcript: Mouse XR_377103.3

PREDICTED: Mus musculus neutrophil cytosolic factor 1 (Ncf1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ncf1 (17969)
Length:
1492
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_377103.3
NBCI Gene record:
Ncf1 (17969)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_377103.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070648 CGGCTATTTCCCATCCATGTA pLKO.1 754 3UTR 100% 4.950 6.930 N Ncf1 n/a
2 TRCN0000070652 TGTGTACATGTTCCTGGTTAA pLKO.1 128 3UTR 100% 10.800 7.560 N Ncf1 n/a
3 TRCN0000038927 CCAGCACTATGTGTACATGTT pLKO.1 119 3UTR 100% 4.950 3.465 N NCF1C n/a
4 TRCN0000070649 CCCATCATCCTTCAGACCTAT pLKO.1 519 3UTR 100% 4.950 3.465 N Ncf1 n/a
5 TRCN0000038925 CCGAGATCTACGAGTTCCATA pLKO.1 190 3UTR 100% 4.950 3.465 N NCF1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_377103.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.