Transcript: Mouse XR_378277.2

PREDICTED: Mus musculus family with sequence similarity 160, member A2 (Fam160a2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam160a2 (74349)
Length:
10913
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_378277.2
NBCI Gene record:
Fam160a2 (74349)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_378277.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201537 CGCCTTTCTTGTTGGATACTT pLKO.1 3280 3UTR 100% 5.625 7.875 N Fam160a2 n/a
2 TRCN0000189466 CGGACTAAGAAACGCAGTCTA pLKO.1 2173 3UTR 100% 4.950 6.930 N Fam160a2 n/a
3 TRCN0000200826 GCTGGTTGATTATATTCACAA pLKO.1 1323 3UTR 100% 4.950 6.930 N Fam160a2 n/a
4 TRCN0000191895 GCTGAACAGTTGAAACTATTT pLKO.1 742 3UTR 100% 13.200 10.560 N Fam160a2 n/a
5 TRCN0000129338 CCCTTGCACTCTTCATGAGTT pLKO.1 1247 3UTR 100% 4.950 3.465 N FAM160A2 n/a
6 TRCN0000190132 CCTCGCCTTTCTTGTTGGATA pLKO.1 3277 3UTR 100% 4.950 3.465 N Fam160a2 n/a
7 TRCN0000128043 GAACTCCGTCTATGTCAACTT pLKO.1 2676 3UTR 100% 4.950 3.465 N FAM160A2 n/a
8 TRCN0000201374 GAAGACAATTACCTGGAGTAT pLKO.1 2044 3UTR 100% 4.950 3.465 N Fam160a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_378277.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.