Transcript: Mouse XR_378659.1

PREDICTED: Mus musculus transmembrane and coiled-coil domains 3 (Tmco3), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmco3 (234076)
Length:
2768
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_378659.1
NBCI Gene record:
Tmco3 (234076)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_378659.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192703 GCCTACGATGTTTGGGTATAT pLKO.1 1148 3UTR 100% 13.200 18.480 N Tmco3 n/a
2 TRCN0000314452 GCCTACGATGTTTGGGTATAT pLKO_005 1148 3UTR 100% 13.200 18.480 N Tmco3 n/a
3 TRCN0000200883 GACGACAATAAATCAGTCAAA pLKO.1 879 3UTR 100% 4.950 6.930 N Tmco3 n/a
4 TRCN0000192232 CGTATCTCATAGGACCGTATT pLKO.1 1649 3UTR 100% 10.800 8.640 N Tmco3 n/a
5 TRCN0000314390 CGTATCTCATAGGACCGTATT pLKO_005 1649 3UTR 100% 10.800 8.640 N Tmco3 n/a
6 TRCN0000192772 CCTCATGCTTGCTTGCTATTT pLKO.1 2376 3UTR 100% 13.200 9.240 N Tmco3 n/a
7 TRCN0000314391 CCTCATGCTTGCTTGCTATTT pLKO_005 2376 3UTR 100% 13.200 9.240 N Tmco3 n/a
8 TRCN0000201140 CTTCCCTTCTTTCACCTGATA pLKO.1 306 3UTR 100% 4.950 3.465 N Tmco3 n/a
9 TRCN0000191348 CCAGAGTAATTTATTTGCAGT pLKO.1 2428 3UTR 100% 2.640 1.848 N Tmco3 n/a
10 TRCN0000314392 CCAGAGTAATTTATTTGCAGT pLKO_005 2428 3UTR 100% 2.640 1.848 N Tmco3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_378659.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.