Transcript: Mouse XR_379128.3

PREDICTED: Mus musculus queuine tRNA-ribosyltransferase 1 (Qtrt1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Qtrt1 (60507)
Length:
2149
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_379128.3
NBCI Gene record:
Qtrt1 (60507)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_379128.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328854 TGAGTCCGCTCCACGAATAAT pLKO_005 866 3UTR 100% 15.000 21.000 N Qtrt1 n/a
2 TRCN0000353443 CAGATGCATCGCAGCCCATAA pLKO_005 1385 3UTR 100% 10.800 8.640 N Qtrt1 n/a
3 TRCN0000353444 GGTTGGCTATGCCACCGATTT pLKO_005 1626 3UTR 100% 10.800 8.640 N Qtrt1 n/a
4 TRCN0000328857 ACCTAACCGTGCACAACATTG pLKO_005 1877 3UTR 100% 10.800 7.560 N Qtrt1 n/a
5 TRCN0000328855 CGAAACTTCATGCGCACTATG pLKO_005 1966 3UTR 100% 10.800 7.560 N Qtrt1 n/a
6 TRCN0000110403 CAAGGCACAGTTCTGGAAGAT pLKO.1 1551 3UTR 100% 4.950 3.465 N Qtrt1 n/a
7 TRCN0000110404 CAGTTGAAGAAGAAGCAGTAT pLKO.1 1744 3UTR 100% 4.950 3.465 N Qtrt1 n/a
8 TRCN0000110402 CCGGACAAGCAGAACCTCTTT pLKO.1 1410 3UTR 100% 4.950 3.465 N Qtrt1 n/a
9 TRCN0000110401 CTACAGCACTACACCACCTAA pLKO.1 1862 3UTR 100% 4.950 3.465 N Qtrt1 n/a
10 TRCN0000110400 TCGGACATCATCATGCAGTTA pLKO.1 1290 3UTR 100% 4.950 3.465 N Qtrt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_379128.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.