Transcript: Mouse XR_379440.3

PREDICTED: Mus musculus phosphopantothenoylcysteine decarboxylase (Ppcdc), transcript variant X15, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppcdc (66812)
Length:
2220
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_379440.3
NBCI Gene record:
Ppcdc (66812)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_379440.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249087 CTGCTACTGGAAGGGTAATTG pLKO_005 1317 3UTR 100% 13.200 18.480 N Ppcdc n/a
2 TRCN0000257833 CTACAGTGACGCTGATGAATG pLKO_005 427 3UTR 100% 10.800 8.640 N Ppcdc n/a
3 TRCN0000249088 CCTTTGGCTACGTGGAGATTC pLKO_005 911 3UTR 100% 10.800 7.560 N Ppcdc n/a
4 TRCN0000249089 CTGCCTCTCCTGGTATCTAAG pLKO_005 317 3UTR 100% 10.800 7.560 N Ppcdc n/a
5 TRCN0000338747 ACGCTGATGAATGGGAGATAT pLKO_005 435 3UTR 100% 13.200 18.480 N PPCDC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_379440.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08795 pDONR223 100% 23.7% None (many diffs) n/a
2 ccsbBroad304_08795 pLX_304 0% 23.7% V5 (many diffs) n/a
3 TRCN0000468747 ATAGACGGAGAAGCAGACGTCGGT pLX_317 74.6% 23.7% V5 (many diffs) n/a
Download CSV