Transcript: Mouse XR_379760.1

PREDICTED: Mus musculus NIMA (never in mitosis gene a)-related expressed kinase 11 (Nek11), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nek11 (208583)
Length:
2102
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_379760.1
NBCI Gene record:
Nek11 (208583)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_379760.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378447 GAAATCTCTGTTGGCGAATTA pLKO_005 655 3UTR 100% 13.200 18.480 N Nek11 n/a
2 TRCN0000222223 CCGCTTTGATTGCAAGAAGAT pLKO.1 536 3UTR 100% 4.950 6.930 N Nek11 n/a
3 TRCN0000222224 CCCACTTGTTGCTGAACAATA pLKO.1 1776 3UTR 100% 1.320 1.848 N Nek11 n/a
4 TRCN0000378500 ATTGTTGACCTCGGACATTAT pLKO_005 1741 3UTR 100% 13.200 9.240 N Nek11 n/a
5 TRCN0000378456 GAACTAGATGAACGGACTTTG pLKO_005 1648 3UTR 100% 10.800 7.560 N Nek11 n/a
6 TRCN0000222226 CCATTGTCAGATTCCATGCAA pLKO.1 740 3UTR 100% 3.000 2.100 N Nek11 n/a
7 TRCN0000222225 CCTTACATGGAAGAGCAGCTT pLKO.1 1324 3UTR 100% 2.640 1.848 N Nek11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_379760.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.