Transcript: Mouse XR_380033.3

PREDICTED: Mus musculus mitochondrial translational release factor 1-like (Mtrf1l), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mtrf1l (108853)
Length:
3717
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_380033.3
NBCI Gene record:
Mtrf1l (108853)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_380033.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429525 TTATGAGGCTCTAGTAGAAAT pLKO_005 1591 3UTR 100% 13.200 18.480 N Mtrf1l n/a
2 TRCN0000189488 CCAGCAGTACGCTGCATTTAA pLKO.1 1064 3UTR 100% 15.000 10.500 N Mtrf1l n/a
3 TRCN0000437150 CACGACCTTGAGAGCTTTATG pLKO_005 1517 3UTR 100% 13.200 9.240 N Mtrf1l n/a
4 TRCN0000192901 GCATCAGATTATCTCACTGTT pLKO.1 938 3UTR 100% 4.950 3.465 N Mtrf1l n/a
5 TRCN0000200693 GTGAAATAGCTTTGTGTCAAA pLKO.1 898 3UTR 100% 4.950 3.465 N Mtrf1l n/a
6 TRCN0000149953 GCTGAAGCATCAGATTATCTT pLKO.1 932 3UTR 100% 5.625 3.938 N MTRF1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_380033.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.