Transcript: Mouse XR_380964.3

PREDICTED: Mus musculus poly(A) polymerase gamma (Papolg), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Papolg (216578)
Length:
6087
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_380964.3
NBCI Gene record:
Papolg (216578)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_380964.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250314 CAAGAGTTGGGCACCATAAAT pLKO_005 3138 3UTR 100% 15.000 21.000 N Papolg n/a
2 TRCN0000250312 GGCAAAGCGCCGTGGTATTTA pLKO_005 924 3UTR 100% 15.000 21.000 N Papolg n/a
3 TRCN0000250311 GTCTGGGATCCTCGGGTAAAT pLKO_005 1129 3UTR 100% 13.200 18.480 N Papolg n/a
4 TRCN0000218873 CTATGCCTATTCCAACTATTG pLKO_005 2321 3UTR 100% 10.800 15.120 N PAPOLG n/a
5 TRCN0000229405 ATGTGGTTCCTTGGGATAATT pLKO_005 1540 3UTR 100% 15.000 10.500 N PAPOLG n/a
6 TRCN0000250315 ATGTGGTTCCTTGGGATAATT pLKO_005 1540 3UTR 100% 15.000 10.500 N Papolg n/a
7 TRCN0000250313 ATGAAGCCATTTGGAGTATTT pLKO_005 370 3UTR 100% 13.200 9.240 N Papolg n/a
8 TRCN0000053221 CCTTCTGTTGTGGCTACTGTT pLKO.1 493 3UTR 100% 4.950 3.465 N PAPOLG n/a
9 TRCN0000174172 CCTTCTGTTGTGGCTACTGTT pLKO.1 493 3UTR 100% 4.950 3.465 N PAPOLG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_380964.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03982 pDONR223 100% 33.2% None (many diffs) n/a
2 ccsbBroad304_03982 pLX_304 0% 33.2% V5 (many diffs) n/a
Download CSV