Transcript: Mouse XR_382233.1

PREDICTED: Mus musculus serine palmitoyltransferase, long chain base subunit 1 (Sptlc1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sptlc1 (268656)
Length:
2571
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_382233.1
NBCI Gene record:
Sptlc1 (268656)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_382233.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103403 CCCTTCCAGAACTGGTTAAAT pLKO.1 835 3UTR 100% 15.000 21.000 N Sptlc1 n/a
2 TRCN0000103401 CGAGGGTTCTATGGCACATTT pLKO.1 474 3UTR 100% 13.200 18.480 N Sptlc1 n/a
3 TRCN0000103404 GAGCACTATGGGATCAGTATT pLKO.1 939 3UTR 100% 13.200 18.480 N Sptlc1 n/a
4 TRCN0000288289 GAGCACTATGGGATCAGTATT pLKO_005 939 3UTR 100% 13.200 18.480 N Sptlc1 n/a
5 TRCN0000103400 GCGAGCGTGTTGAGTGATATA pLKO.1 2276 3UTR 100% 13.200 18.480 N Sptlc1 n/a
6 TRCN0000288225 GCGAGCGTGTTGAGTGATATA pLKO_005 2276 3UTR 100% 13.200 18.480 N Sptlc1 n/a
7 TRCN0000295624 GACCGAAGAAGCCATCATTTA pLKO_005 539 3UTR 100% 13.200 9.240 N Sptlc1 n/a
8 TRCN0000103402 CCCTGCTCTCAACTACAACAT pLKO.1 299 3UTR 100% 4.950 2.970 N Sptlc1 n/a
9 TRCN0000288288 CCCTGCTCTCAACTACAACAT pLKO_005 299 3UTR 100% 4.950 2.970 N Sptlc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_382233.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.