Transcript: Mouse XR_383213.3

PREDICTED: Mus musculus PIN2/TERF1 interacting, telomerase inhibitor 1 (Pinx1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pinx1 (72400)
Length:
1472
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_383213.3
NBCI Gene record:
Pinx1 (72400)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_383213.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071227 CCGGGTTCATTATATGAAATT pLKO.1 497 3UTR 100% 13.200 18.480 N Pinx1 n/a
2 TRCN0000071226 GTAGAAATAGACGCCACACTA pLKO.1 1176 3UTR 100% 4.950 3.960 N Pinx1 n/a
3 TRCN0000071223 GCCAAGAGAATGGCCCAATTA pLKO.1 807 3UTR 100% 13.200 9.240 N Pinx1 n/a
4 TRCN0000071225 GTGGTCTAAAGGAAAGGGTTT pLKO.1 245 3UTR 100% 4.050 2.835 N Pinx1 n/a
5 TRCN0000071224 GCCTTCACCATCCAGGAATAT pLKO.1 783 3UTR 100% 13.200 7.920 N Pinx1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_383213.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.