Transcript: Mouse XR_384540.3

PREDICTED: Mus musculus YEATS domain containing 2 (Yeats2), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Yeats2 (208146)
Length:
4215
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_384540.3
NBCI Gene record:
Yeats2 (208146)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_384540.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219117 ACAAGCGGATAGATATCATAC pLKO_005 1086 3UTR 100% 10.800 15.120 N Yeats2 n/a
2 TRCN0000417949 TCATTGACCAGCGACTGATTG pLKO_005 387 3UTR 100% 10.800 15.120 N YEATS2 n/a
3 TRCN0000234216 AGCTAAGCAACTACGTCATTA pLKO_005 3382 3UTR 100% 13.200 10.560 N Yeats2 n/a
4 TRCN0000234215 GCAACTACCAGCCACTAATTT pLKO_005 2404 3UTR 100% 15.000 10.500 N Yeats2 n/a
5 TRCN0000219064 TTCCTTCATCCTAGCTATAAA pLKO_005 962 3UTR 100% 15.000 9.000 N Yeats2 n/a
6 TRCN0000432505 AGTACAGGAAGTCCTACAAAC pLKO_005 1730 3UTR 100% 10.800 7.560 N YEATS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_384540.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08565 pDONR223 100% 76.3% None (many diffs) n/a
2 ccsbBroad304_08565 pLX_304 0% 76.3% V5 (many diffs) n/a
Download CSV