Transcript: Mouse XR_387156.3

PREDICTED: Mus musculus dual serine/threonine and tyrosine protein kinase (Dstyk), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dstyk (213452)
Length:
3287
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_387156.3
NBCI Gene record:
Dstyk (213452)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_387156.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088497 GCAAGAGGAAATGAAGGATAT pLKO.1 1654 3UTR 100% 10.800 7.560 N Dstyk n/a
2 TRCN0000288103 GCAAGAGGAAATGAAGGATAT pLKO_005 1654 3UTR 100% 10.800 7.560 N Dstyk n/a
3 TRCN0000088495 CCTGTGATAACCTATGCACTT pLKO.1 1160 3UTR 100% 4.050 2.835 N Dstyk n/a
4 TRCN0000288104 CCTGTGATAACCTATGCACTT pLKO_005 1160 3UTR 100% 4.050 2.835 N Dstyk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_387156.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.