Transcript: Mouse XR_387572.2

PREDICTED: Mus musculus coenzyme Q5 methyltransferase (Coq5), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Coq5 (52064)
Length:
1950
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_387572.2
NBCI Gene record:
Coq5 (52064)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_387572.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295270 GCGTTCCGGTTCCTTAGTTAC pLKO_005 408 3UTR 100% 10.800 15.120 N Coq5 n/a
2 TRCN0000097540 CCTACCAATACCTTGTGGAAA pLKO.1 797 3UTR 100% 4.950 6.930 N Coq5 n/a
3 TRCN0000287980 CCTACCAATACCTTGTGGAAA pLKO_005 797 3UTR 100% 4.950 6.930 N Coq5 n/a
4 TRCN0000163240 GATCCGGAATGTCACACACAT pLKO.1 701 3UTR 100% 4.950 6.930 N COQ5 n/a
5 TRCN0000295271 TGACGACAGCTTTGATGTTTA pLKO_005 665 3UTR 100% 13.200 9.240 N Coq5 n/a
6 TRCN0000097539 CCACATCAGAACGCTGACAAT pLKO.1 1311 3UTR 100% 4.950 3.465 N Coq5 n/a
7 TRCN0000287905 CCACATCAGAACGCTGACAAT pLKO_005 1311 3UTR 100% 4.950 3.465 N Coq5 n/a
8 TRCN0000097543 GAGACTGGAAGTCCTACCAAT pLKO.1 785 3UTR 100% 4.950 3.465 N Coq5 n/a
9 TRCN0000097541 CGAGCTTGGAAGGATTTGCTT pLKO.1 321 3UTR 100% 3.000 2.100 N Coq5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_387572.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.